other:
Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Article Title: Single-cell epigenetic analysis reveals principles of chromatin states in H3.3-K27M gliomas.
Article Snippet: Alfa Aesar Cat#J61620; CAS# 7783-20-2 Methanol absolute Bio-Lab Cat#001368052100; CAS#67-56-1 G418 disulfate salt Merck Cat#A1720; CAS# 108321-42-2 Vorinostat MCE Cat#HY-10221; CAS# 149647-78-9 Doxycycline Hyclate Merck Cat#D9891; CAS# 24390-14-5 Lipofectamine 2000 Transfection Reagent Thermo Fisher Cat#11668027 DAPI Thermo Fisher Cat#62248 ProLong Gold antifade reagent Thermo Fisher Cat#P10144 RNasin Plus Ribonuclease Inhibitor Promega Cat#N2611 Neurobasal-A medium Thermo Fisher Cat#10888022 DMEM-F12 Thermo Fisher Cat#11330032 DMEM Thermo Fisher Cat#41965-039 HEPES buffer Thermo Fisher Cat#15630056 MEM sodium-pyruvate Thermo Fisher Cat#11360039 MEM non-essential amino acids Thermo Fisher Cat#11140035 Glutamax Thermo Fisher Cat#35050038 antibiotic antimycotic Thermo Fisher Cat#15240096 B-27 supplement w/o vitamin A Thermo Fisher Cat#12587010 H-EGF Shenandoah Cat#100-26 H-FGF-basic-154 Shenandoah Cat#100-146 H-PDGF-AA Shenandoah Cat#100-16 H-PDGF-BB Shenandoah Cat#100-18 Heparin sodium salt from porcine intestinal mucosa Merck Cat#H3149; CAS# 9041-08-1 TrypLE Express Thermo Fisher Cat#12604013 DNase I Worthington Cat#LS002007 HBSS Merck Cat#H6648 Maxpar nuclear antigen staining buffer set Fluidigm Cat#201063 Maxpar PBS Fluidigm Cat#201058 Maxpar cell staining buffer Fluidigm Cat#201068 Maxpar cell acquisition solution Fluidigm Cat#201240 Cell-ID Cisplatin Fluidigm Cat#201064 Cell-ID Intercalator-Ir Fluidigm Cat#201192A Cell-ID IdU Fluidigm Cat#201127 OptiMEM I reduced serum medium Thermo Fisher Cat#31985070 Poly-L-Lysine Solution, 0.01%, Sterile-F Merck Cat#P4707 Opal 690 Reagent Pack Akoya Biosciences Cat#FP1497001KT Puromycin solution Invivogen Cat#ant-pr; CAS#58-58-2 Cy2 Streptavidin Jackson Cat#016-220-084 Critical Commercial Assays NextSeq 500/550 High Output Kit v2.5 (75 Cycles) Illumina Cat#20024906 RNeasy Micro Kit Qiagen Cat#74004 (Continued on next page) e3 Molecular Cell 82, 2696–2713.e1–e9, July 21, 2022
Cell Culture:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Next-Generation Sequencing:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Purification:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Blocking Assay:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Suspension:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Recombinant:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Diff-Quik:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Staining:Article Title: Small intestinal resident eosinophils maintain gut homeostasis following microbial colonization.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HyClone HEPES 1M Solution GE Healthcare Cell Culture Cat# SH30237.01 Fluorescein isothiocyanate–dextran, 4kDa Sigma Cat# 46944-100MG-F Carmine, powder Sigma Cat# C1022-5G Methyl cellulose, 400cP Sigma Cat# M0262-100G BrdU (5-Bromo-20-deoxyuridine) Sigma Cat# 19-160 Mucin from porcine stomach, Type II Sigma Cat# M2378-100G Sodium azide Sigma Cat# S2002-100G Bovine Serum Albumin Sigma Cat# A7030-500G Saponin Sigma Cat# 84510-100G Glutaraldehyde fixative Agar Scientific Cat# AGR1009 KAPA HiFi Hot Start Ready Mix Roche Cat# KK2602 NucleoMag NGS clean-up beads Macherey-Nagel Cat# 744970.50 Cisplatin BioVision Cat# 1550-1000 Iridium Fluidigm Cat# 201192B EQ Four Element Calibration Beads Fluidigm Cat# 201078 Maxpar Cell Acquisition Solution Fluidigm Cat# 201240 SPI-Chem Osmium Tetroxide SPI Supplies Cat# 20816-12-0 Trizma maleate buffer Sigma Cat# 913-50ML Epoxy embedding medium Sigma Cat# 45345 Toluidine Blue Sigma Cat# 89640 Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block) (2.4G2) BD Cat# 553141 EdU (5-ethynyl-2’- deoxyuridine) ThermoScientific Cat# A10044 ProLong Gold Antifade Reagent Invitrogen Cat# P36934 FocusClear CellExplorer Cat# FC-101 Liberase TL Roche Cat# 5401020001 DNaseI Roche Cat# 04536282001 Bactrim (oral suspension) Bayer Cat# SAP-10068284 Dafalgan/Paracetamol Bayer Cat# N02BE01 Sodium Chloride Sigma Aldrich 71382-1KG Potassium Chloride Sigma Aldrich 60130-1KG Potassium phosphate monobasic Sigma Aldrich 60218-1KG Magnesium sulfate heptahydrate Sigma Aldrich 63140-1KG-F D(+) Glucose Sigma Aldrich G7021-1KG Sodium bicarbonate Sigma Aldrich S8875-1KG Calcium chloride dihydrate Sigma Aldrich C7902-1KG Acetylcholine chloride Sigma Aldrich A2661-25G Recombinant Murine Stem Cell Factor PeproTech 250-03 Recombinant Murine FLT-3 Ligand PeproTech 250-31L Recombinant Murine IL-5 PeproTech 215-15 IMDM with Glutamax-I Life Technologies, Invitrogen 31980-097 Diff-Quick Stain Kit Thermo Fisher Scientific 23-122-929, 23-122-952, and 23-122-937) Olive Oil Sigma O1514 Critical commercial assays Mouse Isotyping Panel 1 kit Meso Scale Discovery Cat# K15183B-2 SequalPrep Normalization Plate Kit Invitrogen Cat# A10510-01 Qubit HS DNA kit Invitrogen Cat# Q33230 Tapestation D1000 assay Agilent Cat# G2991AA V2-500 cycle kit Illumina Cat# MS-102-2003 (Continued on next page) e3 Immunity 55, 1250–1267.e1–e12, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER MaxPar Antibody Labeling kit Fluidigm Cat# 201300 Click-iT Plus EdU Alexa Fluor 555 Imaging Kit ThermoScientific Cat # C10638 RNeasy Plus Universal Mini Kit Qiagen Cat# 73404 RNase-Free DNase Set Qiagen Cat# 79254 TruSeq Stranded mRNA Illumina Cat# 20020594 NextSeq 500/550 High Output v2 kit (75 cycles) Illumina FC-404-2005 KAPA RNA HyperPrep Kit with RiboErase (HMR) KAPA Biosystems KK8560 QIAamp DNA stool mini kit Qiagen 51504 a-CD90.2 Microbeads (T-cell depletion) Milteny Biotech Cat. 130-049-101 Anti-Siglec-F MicroBeads, mouse Miltenyi Biotec 130-118-513 Deposited data TMT data This paper Pride: PXD033288 Proteomic data shown in Figure S6G This paper ProteomeXchange: PXD032084 Microbiome 16S rRNA gene sequences - MiSEQ This paper NCBI BioProject: PRJNA832754 Microbiome 16S rRNA gene sequences – Ion Torrent This paper NCBI BioProject: PRJNA832494 RNAseq data This paper GEO: GSE201355 Experimental models: Organisms/strains C57BL/6J Jackson Laboratory JAX Stock:000664 BALB/cJ In-house breeding JAX Stock: 000651 Ddbl.GATA1 In-house breeding Yu et al. (2002); JAX Stock: 005653 NOD.SCIDxgc In-house breeding Schultz et al. (2005); JAX Stock: 005507 NOD.SCID In-house breeding Prochazka et al. (1992); JAX Stock: 001303 Rag2ko Jackson Laboratory Hao and Rajewsky (2001); JAX Stock: 008449 Myd88-/- In-house breeding Adachi et al. (1998) ST2-/-xIL17rb-/- In-house breeding JAX Stock: 4457616 X 2386675 Oligonucleotides 50AATGATACGGCGACCACCGAGA TCTACAC i5BARCODE TATGGTAATT GTGTGCCAGCMGCCGCGGTAA-30 IDT N/A 50-CAAGCAGAAGACGGCATACG AGAT i7BARCODE AGTCAGTCAGC CGGACTACHVGGGTWTCTAAT-30 IDT N/A Software and algorithms Andromeda algorithm ACS Publications https://pubs.acs.org/doi/10.1021/pr101065j MaxQuant software package v.1.6.0.1 MaxQuant https://www.maxquant.org/ Graphpad Prism Graphpad https://www.graphpad.com/ FlowJo FlowJo https://www.flowjo.com Image analysis software iTEM iTEM http://www.resaltatech.com/ item_overview.htm ImageJ Schneider et al., 2012 https://imagej.nih.gov/ij/ Angiotool Zudaire et al., 2011 A computational tool for quantitative analysis of vascular networks.
Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Activation Assay:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Extraction:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Magnetic Cell Separation:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Infection:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Luciferase:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Cell Isolation:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Lysis:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
BIA-KA:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
Protease Inhibitor:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
RNA sequencing:Article Title: Sialyl-Lewis X Glycoantigen Is Enriched on Cells with Persistent HIV Transcription during Therapy
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains dfHIV Generously provided to us by Dr. Leonard Chavez at Vitalant Research Institute N/A HIV-1 IIIB The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 89.6 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 DH12 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A HIV-1 NL43 The Virus and Reservoirs Core at Penn Center for AIDS Research N/A Biological Samples CD4+ T cells isolated from PBMC of HIVinfected antiretroviral therapy (ART)suppressed individuals External Quality Assurance Program Oversight Laboratory (EQAPOL)- Duke Human Vaccine Institute’s Immunology and Virology Quality N/A CD4+ T cells isolated from PBMC of HIVinfected ART-suppressed individuals The Wistar Institute and Philadelphia FIGHT N/A PBMCs fromHIV-infected viremic and ARTtreated individuals INER-CIENI (Mexico) N/A PBMC from healthy individuals University of Pennsylvania Human Immunology Core N/A Normal mouse serum Thermo Fisher cat# 501121171 Normal rat serum Thermo Fisher cat# 10710C Human serum Sigma-Aldrich cat# H4522-20ML Chemicals, Peptides, and Recombinant Proteins RPMI 1640 medium Corning cat# 10-040-CM Penicillin-Streptomycin GIBCO cat# 15140163 Fetal Bovine Serum GIBCO cat# 10437028 Recombinant Human IL-2 Prepotech cat# 200-20 Recombinant Human TNF-a Prepotech cat# 300-01A cis-Diammineplatinum(II) dichloride Sigma-Aldrich cat# P4394-25MG AOL-biotin conjugated TCI America cat# A26591ML APC Streptavidin Biolegend cat# 405207 Ulex Europaeus Agglutinin I (UEA I), Fluorescein Vector Labs cat# FL-1061-2 Critical Commercial Assays TaqMan Universal Master Mix II, with UNG Applied Biosystems cat# 4440038 TaqMan Copy Number Reference Assay, human, TERT Applied Biosystems cat# 4403316 TaqMan RNA-to-CT 1-Step Kit Applied Biosystems cat# 4392656 Human RPLP0 (Large Ribosomal Protein) Endogenous Control Applied Biosystems cat# 4310879E Brilliant Stain Buffer Plus BD BioSciences cat# 566385 Fixation/Permeabilization Solution Kit BD BioSciences cat# 554714 Perm/Wash Buffer BD BioSciences cat# 554723 Blotting-Grade Blocker BIO-RAD cat# 1706404 Falcon 48-well Clear Flat Bottom TCtreated Cell Culture Plate Corning cat# 353230 Foxp3 / Transcription Factor Staining Buffer Set eBioscience cat# 00-5523-00 (Continued on next page) e2 Cell Reports 32, 107991, August 4, 2020 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Cell-ID 20-Plex Pd Barcoding Kit Fluidigm cat# 201060 CyFACS buffer Fluidigm cat# MB-008 Cell-IDTM DNA Intercalator-Ir Fluidigm cat# 201192A Maxpar cell staining buffer Fluidigm cat# 201068 Maxpar PBS Fluidigm cat# 201058 Maxpar Cell Acquisition Solution Fluidigm cat# 201240 EQTM calibration beads Fluidigm cat# 201078 Cy 3 Mono 5-pack GE Healthcare cat# GEPA23001 Dynabeads Human T-Activator CD3/CD28 for T Cell Expansion and Activation GIBCO cat# 11131D eBioscience Foxp3 / Transcription Factor Staining Buffer Se Invitrogen cat# 00-5523-00 LIVE/DEAD Fixable Violet Dead Cell Stain Kit, for 405 nm excitation Invitrogen cat# L34955 ProteoExtract Subcellular Proteome Extraction Kit Merck cat# 539790 DEAE-dextran MilliporeSigma cat# D-9885 Anti-rat kappa MicroBeads Miltenyi Biotec cat# 130-047-401 LS columns Miltenyi Biotec cat# 130-042-401 QuadroMACS Separator Miltenyi Biotec cat# 130-090-976 MACS MultiStand Miltenyi Biotec cat# 130-042-303 HIV Infectivity Enhancement Reagent Miltenyi Biotec cat# 130-095-093 NEBNext Ultra RNA Library Prep Kit for Illumina New England Biolabs cat# E7530S Bright-Glo Luciferase Assay System Promega cat# E2610 AllPrep DNA/RNA/miRNA Universal Kit QIAGEN cat# 80224 RNase-Free DNase Set QIAGEN cat# 79254 Bovine Serum Albumin R&D Systems cat# 5217 CyFACS buffer Rockland cat# MB-008 EasySep Human CD4+ T Cell Isolation Kit Stem Cell cat# 17952 NuPAGE 4-12% Bis-Tris Protein Gels, 1.0 mm, 12-well Thermo Fisher cat# NP0322BOX NuPAGE Sample Reducing Agent (10X) Thermo Fisher cat# NP0004 NuPAGE LDS Sample Buffer (4X) Thermo Fisher cat# NP0007 iBlot 2 Transfer Stacks, nitrocellulose, mini Thermo Fisher cat# IB23002 Novex Sharp Pre-stained Protein Standard Thermo Fisher cat# LC5800 SuperSignal West Pico PLUS Chemiluminescent Substrate Thermo Fisher cat# 34580 RIPA Lysis and Extraction Buffer Thermo Fisher cat# 89900 Bicinchoninic acid (BCA) assay Thermo Fisher cat# 23235 Halt Protease Inhibitor Cocktail (100X) Thermo Fisher cat# 87786 CL-XPosure Film, 8 3 10 in. (20 3 25 cm) Thermo Fisher cat# 34091 Deposited Data RNaseq data Deposited to GEO (https://www.ncbi.nlm. nih.gov/geo/) Accession number GSE151453 Experimental Models: Cell Lines ACH-2 NIH AIDS Reagent Program Cat# 349 H9 NIH AIDS Reagent Program Cat# 87 TZM-bl NIH AIDS Reagent Program Cat# 8129 (Continued on next page) Cell Reports 32, 107991, August 4, 2020 e3 Article ll OPEN ACCESS .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides F522-43 (50 GCC TCA ATA AAG CTT GCC TTG A 30 IDT (Kumar et al., 2007) R626-43 (50 GGG CGC CAC TGC TAG AGA 30 IDT (Kumar et al., 2007) FAM-BQprobe (50 CCAGAGTCACACAAC AGA CGG GCA CA 30 IDT (Kumar et al., 2007) Software and Algorithms FlowJo software (Tree Star). https://www.flowjo.com/ RRID:SCR_008520 bowtie2 http://bowtie-bio.sourceforge.net/index. shtml RRID:SCR_005476 RSEM v1.2.12 http://deweylab.biostat.wisc.edu/rsem/ RRID:SCR_013027 DESeq2 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html RRID:SCR_015687 QIAGEN’s Ingenuity Pathway Analysis software https://digitalinsights.qiagen.com/ RRID:SCR_008653 Prism 6.0 and 7.0 http://www.graphpad.com/ RRID:SCR_002798 Rstudio https://rstudio.com/ RRID:SCR_000432 FACSDiva software http://www.bdbiosciences.com/ instruments/software/facsdiva/index.jsp RRID:SCR_001456 HiSeq control software https://www.illumina.com/systems/ sequencing-platforms/hiseq-2500/ products-services/hiseq-control-software. html N/A Article ll OPEN ACCESS
|
fluidigm is a verified supplier 
fluidigm manufactures this product 